Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3154161
End position: 3154196
Length: 36

DNA sequence
>NC_021177, from 3154161 to 3154196 (36 bp); Streptomyces fulvissimus DSM 40593 CGGGGGCGGTTGCGGTTGCGGTTGCGGGAGGGGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3153938-3155335	Sequence	SFUL_2773 - Acyltransferase 3 (Protein is coded in complementary strand; from 3155335 to 3153938)