Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3149259
End position: 3149294
Length: 36

DNA sequence
>NC_021177, from 3149259 to 3149294 (36 bp); Streptomyces fulvissimus DSM 40593 GGTCGGGGGCCTGGCCGGGCGCCTGGCCCGGGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3147599-3149560	Sequence	SFUL_2768 - Secreted protein (Protein is coded in complementary strand; from 3149560 to 3147599)