Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3146817
End position: 3146861
Length: 45

DNA sequence
>NC_021177, from 3146817 to 3146861 (45 bp); Streptomyces fulvissimus DSM 40593 GCCGTCGCCCTCGCTGCCCTTGCCCTCGCCGTCCTTGCCCTCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3145534-3147513	Sequence	SFUL_2767 - Secreted protein (Protein is coded in complementary strand; from 3147513 to 3145534)