Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3119871
End position: 3119915
Length: 45

DNA sequence
>NC_021177, from 3119871 to 3119915 (45 bp); Streptomyces fulvissimus DSM 40593 ACGGGCGTGGCGTCTGCGGGAGTGGCGTGTGCGGGTGTGGCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3117831-3120482	Sequence	SFUL_2740 - SUKH-4 multi-domain protein (Protein is coded in complementary strand; from 3120482 to 3117831)