Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3102988
End position: 3103050
Length: 63

DNA sequence
>NC_021177, from 3102988 to 3103050 (63 bp); Streptomyces fulvissimus DSM 40593 ACCGTGCCGGCCTGGGCGGCTGCCGTAGTGGCCTGGGCGGCTGCCGTGCCGGCCTGGGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3101350-3103662	Sequence	SFUL_2726 - YcaO-domain protein (Protein is coded in complementary strand; from 3103662 to 3101350)