Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3090950
End position: 3090985
Length: 36

DNA sequence
>NC_021177, from 3090950 to 3090985 (36 bp); Streptomyces fulvissimus DSM 40593 GCGTCGAGGGGGGCGTCCCGGGGGGCGTCGAGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3089000-3091009	Sequence	SFUL_2718 - Biosynthesis docking scaffold protein, SagD family (Protein is coded in complementary strand; from 3091009 to 3089000)