Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3088484
End position: 3088510
Length: 27

DNA sequence
>NC_021177, from 3088484 to 3088510 (27 bp); Streptomyces fulvissimus DSM 40593 GCGGTCCGCGCGGTCCGCGCCGTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3087084-3088562	Sequence	SFUL_2716 - M20/M25/M40 family peptidase (Protein is coded in complementary strand; from 3088562 to 3087084)