Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3076387
End position: 3076410
Length: 24

DNA sequence
>NC_021177, from 3076387 to 3076410 (24 bp); Streptomyces fulvissimus DSM 40593 GGTGCGGGCGCGAGTGCGGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3076009-3076599	Sequence	SFUL_2706 - Isochorismatase hydrolase (Protein is coded in complementary strand; from 3076599 to 3076009)