Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3069373
End position: 3069399
Length: 27

DNA sequence
>NC_021177, from 3069373 to 3069399 (27 bp); Streptomyces fulvissimus DSM 40593 TCTTGCCGGTCTTACCGGCCTTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3068871-3069902	Sequence	SFUL_2700 - Putative secreted protein (Protein is coded in complementary strand; from 3069902 to 3068871)