Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3037688
End position: 3037726
Length: 39

DNA sequence
>NC_021177, from 3037688 to 3037726 (39 bp); Streptomyces fulvissimus DSM 40593 GGCTCCGGGCGGCTGCTCCGGGCGGCTGCTCCCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3037727-3038899	Sequence	SFUL_2671 - Imidazolonepropionase (Protein is coded in complementary strand; from 3038899 to 3037727)