Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3034535
End position: 3034570
Length: 36

DNA sequence
>NC_021177, from 3034535 to 3034570 (36 bp); Streptomyces fulvissimus DSM 40593 GGAACCTCCCGTGGAACCGCCGGTCGAACCGCCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3034386-3035105	Sequence	SFUL_2667 - hypothetical protein (Protein is coded in complementary strand; from 3035105 to 3034386)