Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 3031496
End position: 3031540
Length: 45

DNA sequence
>NC_021177, from 3031496 to 3031540 (45 bp); Streptomyces fulvissimus DSM 40593 GGTGCTGCCGCCGGAGTCGCTGCCTCCGGATGTGGTGCCGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3030822-3032264	Sequence	SFUL_2664 - hypothetical protein (Protein is coded in complementary strand; from 3032264 to 3030822)