Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2998703
End position: 2998756
Length: 54

DNA sequence
>NC_021177, from 2998703 to 2998756 (54 bp); Streptomyces fulvissimus DSM 40593 GGGAGCCCGGGGGCTCCGGGGTGGCCGGGGACTCCGGGGTGGCCGGGGACTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2997802-2999340	Sequence	SFUL_2636 - N-acetylmuramoyl-L-alanine amidase family 2 (Protein is coded in complementary strand; from 2999340 to 2997802)