Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2996429
End position: 2996491
Length: 63

DNA sequence
>NC_021177, from 2996429 to 2996491 (63 bp); Streptomyces fulvissimus DSM 40593 CACCGCGTGCGAGCCCCTCTTCGCCGCGCGCAGGCCCCTCTTCGCCGCGCGCGAGCCCCTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2995471-2996565	Sequence	SFUL_2634 - HhH-GPD domain containing protein (Protein is coded in complementary strand; from 2996565 to 2995471)