Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2938395
End position: 2938418
Length: 24

DNA sequence
>NC_021177, from 2938395 to 2938418 (24 bp); Streptomyces fulvissimus DSM 40593 GACGAGGTCGAGGACGAGGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2938006-2938614	Sequence	SFUL_2591 - TetR-family transcriptional regulator (Protein is coded in complementary strand; from 2938614 to 2938006)