Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2923263
End position: 2923298
Length: 36

DNA sequence
>NC_021177, from 2923263 to 2923298 (36 bp); Streptomyces fulvissimus DSM 40593 CGGCGGGCGCCCTGGCCGGCGCCCTGGCCGGCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2923218-2926142	Sequence	SFUL_2584 - CDP-glycerol glycerophosphotransferase (Protein is coded in complementary strand; from 2926142 to 2923218)