Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2909951
End position: 2909986
Length: 36

DNA sequence
>NC_021177, from 2909951 to 2909986 (36 bp); Streptomyces fulvissimus DSM 40593 TGTTGCTGCTGGTGTTGCGGCGGGTACTGCTGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2909606-2911276	Sequence	SFUL_2576 - Serine/threonine protein kinase pkaA (Protein is coded in complementary strand; from 2911276 to 2909606)