Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2871704
End position: 2871757
Length: 54

DNA sequence
>NC_021177, from 2871704 to 2871757 (54 bp); Streptomyces fulvissimus DSM 40593 TCGATGCGCGCGGAGGTGTCGGAGTGCGCGGAGGTGTCGGAGTGCGCGGAGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2870552-2872315	Sequence	SFUL_2542 - (2Fe-2S)-binding domain-containing protein (Protein is coded in complementary strand; from 2872315 to 2870552)