Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2871181
End position: 2871216
Length: 36

DNA sequence
>NC_021177, from 2871181 to 2871216 (36 bp); Streptomyces fulvissimus DSM 40593 GGCCGGGTCGTGCGCGGGGTCGTGGGCCGGGTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2870552-2872315	Sequence	SFUL_2542 - (2Fe-2S)-binding domain-containing protein (Protein is coded in complementary strand; from 2872315 to 2870552)