Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2845534
End position: 2845557
Length: 24

DNA sequence
>NC_021177, from 2845534 to 2845557 (24 bp); Streptomyces fulvissimus DSM 40593 GGCGGGGGCCGGGGCGGGGTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2844422-2845876	Sequence	SFUL_2519 - RDD domain containing protein (Protein is coded in complementary strand; from 2845876 to 2844422)