Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2844119
End position: 2844148
Length: 30

DNA sequence
>NC_021177, from 2844119 to 2844148 (30 bp); Streptomyces fulvissimus DSM 40593 CGGCGGGGGCGGAGGCGGCGGAGGGGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2843589-2844278	Sequence	SFUL_2518 - Putative RDD domain-containing membrane protein (Protein is coded in complementary strand; from 2844278 to 2843589)