Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2799556
End position: 2799591
Length: 36

DNA sequence
>NC_021177, from 2799556 to 2799591 (36 bp); Streptomyces fulvissimus DSM 40593 CCGCCGCCGCCGTCGCCTCCGCCGCCGTCGCCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2799498-2799755	Sequence	SFUL_2474 - Putative hydrolase (Protein is coded in complementary strand; from 2799755 to 2799498)