Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2789052
End position: 2789075
Length: 24

DNA sequence
>NC_021177, from 2789052 to 2789075 (24 bp); Streptomyces fulvissimus DSM 40593 AAGCCGAAGCCGAAGCCGAAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2788493-2789164	Sequence	SFUL_2466 - Secreted protein (Protein is coded in complementary strand; from 2789164 to 2788493)