Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2769598
End position: 2769633
Length: 36

DNA sequence
>NC_021177, from 2769598 to 2769633 (36 bp); Streptomyces fulvissimus DSM 40593 CCGTGTCCCGGTCCGTGCCGCGGTAGGTGTCCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2769564-2770430	Sequence	SFUL_2450 - Membrane protein insertase, YidC/Oxa1 family (Protein is coded in complementary strand; from 2770430 to 2769564)