Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2757263
End position: 2757289
Length: 27

DNA sequence
>NC_021177, from 2757263 to 2757289 (27 bp); Streptomyces fulvissimus DSM 40593 GGGCGGTGGTGGCGGTGGTGGCGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2755816-2757369	Sequence	SFUL_2436 - type I phosphodiesterase/nucleotide pyrophosphatase (Protein is coded in complementary strand; from 2757369 to 2755816)