Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2745201
End position: 2745224
Length: 24

DNA sequence
>NC_021177, from 2745201 to 2745224 (24 bp); Streptomyces fulvissimus DSM 40593 GGGCCTGGGCCTGGGCCTGGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2743631-2745955	Sequence	SFUL_2427 - Band 7 protein (Protein is coded in complementary strand; from 2745955 to 2743631)