Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2703230
End position: 2703259
Length: 30

DNA sequence
>NC_021177, from 2703230 to 2703259 (30 bp); Streptomyces fulvissimus DSM 40593 CTCCTGCCCCTGCTCCTGCTCGTGCCCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2701755-2703839	Sequence	SFUL_2390 - Stress protein (Protein is coded in complementary strand; from 2703839 to 2701755)