Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2670178
End position: 2670204
Length: 27

DNA sequence
>NC_021177, from 2670178 to 2670204 (27 bp); Streptomyces fulvissimus DSM 40593 CGCTGGTCTCGCTGGTCTCGCTGGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2668950-2670218	Sequence	SFUL_2364 - hypothetical protein (Protein is coded in complementary strand; from 2670218 to 2668950)