Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2653120
End position: 2653164
Length: 45

DNA sequence
>NC_021177, from 2653120 to 2653164 (45 bp); Streptomyces fulvissimus DSM 40593 TGCGGTACGGGAGCTTCCGGTGCGGGAGCTTGCGGCGCGGGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2652667-2653695	Sequence	SFUL_2349 - hypothetical protein (Protein is coded in complementary strand; from 2653695 to 2652667)