Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2569036
End position: 2569080
Length: 45

DNA sequence
>NC_021177, from 2569036 to 2569080 (45 bp); Streptomyces fulvissimus DSM 40593 GCTGCTGGGCTGTGTGCTGCTGGGCTGTGTGCTGCTGGGCTGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2568936-2570009	Sequence	SFUL_2277 - IolB protein (Protein is coded in complementary strand; from 2570009 to 2568936)