Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2564490
End position: 2564534
Length: 45

DNA sequence
>NC_021177, from 2564490 to 2564534 (45 bp); Streptomyces fulvissimus DSM 40593 CGGGGGCCGGGGCTCCGGGGGCCGGGGCTCCGGGGGCCGGGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2563385-2564677	Sequence	SFUL_2273 - Two-component system sensor kinase (Protein is coded in complementary strand; from 2564677 to 2563385)