Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2552617
End position: 2552640
Length: 24

DNA sequence
>NC_021177, from 2552617 to 2552640 (24 bp); Streptomyces fulvissimus DSM 40593 GTCCCCCCGGCCCCCCGGCCCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2551742-2552617	Sequence	SFUL_2263 - N-acetylmuramoyl-L-alanine amidase family 2