Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2508583
End position: 2508609
Length: 27

DNA sequence
>NC_021177, from 2508583 to 2508609 (27 bp); Streptomyces fulvissimus DSM 40593 CGGCGAGGTCGGCCAGGTCGCCGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2507019-2509271	Sequence	SFUL_2229 - 4-alpha-glucanotransferase Precursor (Protein is coded in complementary strand; from 2509271 to 2507019)