Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2451449
End position: 2451493
Length: 45

DNA sequence
>NC_021177, from 2451449 to 2451493 (45 bp); Streptomyces fulvissimus DSM 40593 GTGCTGCTCCAGCGTGTCCTGGTCCAGGGTGCGCAGCTCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2451186-2451599	Sequence	SFUL_2181 - NDK Nucleoside diphosphate kinase (Protein is coded in complementary strand; from 2451599 to 2451186)