Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2437818
End position: 2437853
Length: 36

DNA sequence
>NC_021177, from 2437818 to 2437853 (36 bp); Streptomyces fulvissimus DSM 40593 GCGACCGGCTCGGCGGCCGGCTCGGCCACGGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2434248-2438489	Sequence	SFUL_2171 - Ribonuclease E (Protein is coded in complementary strand; from 2438489 to 2434248)