Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2405378
End position: 2405422
Length: 45

DNA sequence
>NC_021177, from 2405378 to 2405422 (45 bp); Streptomyces fulvissimus DSM 40593 GCGGTCCGACGCCGTACCGTCCGACACCGTACGGTCCGACGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2404221-2405435	Sequence	SFUL_2149 - Glutamate 5-kinase (Protein is coded in complementary strand; from 2405435 to 2404221)