Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2403018
End position: 2403041
Length: 24

DNA sequence
>NC_021177, from 2403018 to 2403041 (24 bp); Streptomyces fulvissimus DSM 40593 GGAGGCGTAGGCGGAGGAGGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2402221-2403504	Sequence	SFUL_2147 - Gamma-glutamyl phosphatereductase (Protein is coded in complementary strand; from 2403504 to 2402221)