Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2400142
End position: 2400168
Length: 27

DNA sequence
>NC_021177, from 2400142 to 2400168 (27 bp); Streptomyces fulvissimus DSM 40593 GGGTCCTGGAGGTCCTGGGGGTCCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2399055-2400191	Sequence	SFUL_2144 - Peptidase M48 Ste24p
ORF. 2400109-2401257	Sequence	SFUL_2145 - Membrane protein (Protein is coded in complementary strand; from 2401257 to 2400109)