Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2384124
End position: 2384153
Length: 30

DNA sequence
>NC_021177, from 2384124 to 2384153 (30 bp); Streptomyces fulvissimus DSM 40593 GGCCTGGGCCTGTGCCTGTGCCTGTGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2383879-2384634	Sequence	SFUL_2129 - Helix-hairpin-helix motif protein Precursor (Protein is coded in complementary strand; from 2384634 to 2383879)