Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2371488
End position: 2371511
Length: 24

DNA sequence
>NC_021177, from 2371488 to 2371511 (24 bp); Streptomyces fulvissimus DSM 40593 GTCGGCGTGGGCGTCGTCGTCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2371021-2372253	Sequence	SFUL_2120 - Oxygen-independent coproporphyrinogen III oxidase (Protein is coded in complementary strand; from 2372253 to 2371021)