Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2343281
End position: 2343307
Length: 27

DNA sequence
>NC_021177, from 2343281 to 2343307 (27 bp); Streptomyces fulvissimus DSM 40593 GCGGCCTCCGCCGCCTCCGCCGCCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2343272-2344102	Sequence	SFUL_2094 - Undecaprenyl pyrophosphate synthetase 2 (Protein is coded in complementary strand; from 2344102 to 2343272)