Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2297969
End position: 2297992
Length: 24

DNA sequence
>NC_021177, from 2297969 to 2297992 (24 bp); Streptomyces fulvissimus DSM 40593 GGGCGAGGGCGCGGGCCAGGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2297326-2298501	Sequence	SFUL_2037 - 2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (Protein is coded in complementary strand; from 2298501 to 2297326)