Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2228932
End position: 2228961
Length: 30

DNA sequence
>NC_021177, from 2228932 to 2228961 (30 bp); Streptomyces fulvissimus DSM 40593 GGTCGGGGACGGTGTCGGGGTGGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2228903-2229619	Sequence	SFUL_1984 - hypothetical protein (Protein is coded in complementary strand; from 2229619 to 2228903)