Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2176419
End position: 2176442
Length: 24

DNA sequence
>NC_021177, from 2176419 to 2176442 (24 bp); Streptomyces fulvissimus DSM 40593 CCGCCGCCACCGCGGCCGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2176305-2177096	Sequence	SFUL_1929 - SNARE associated Golgi family protein