Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2125941
End position: 2125970
Length: 30

DNA sequence
>NC_021177, from 2125941 to 2125970 (30 bp); Streptomyces fulvissimus DSM 40593 ATGCCGATGCCCGTGCCGATGCCCATGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2123742-2125967	Sequence	SFUL_1888 - putative acyl-CoA dehydrogenase (Protein is coded in complementary strand; from 2125967 to 2123742)