Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2115817
End position: 2115843
Length: 27

DNA sequence
>NC_021177, from 2115817 to 2115843 (27 bp); Streptomyces fulvissimus DSM 40593 CGCCGCCGTCCCCGCCGTCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2114874-2115914	Sequence	SFUL_1881 - ABC-type transporter, periplasmic subunit (Protein is coded in complementary strand; from 2115914 to 2114874)