Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2111386
End position: 2111409
Length: 24

DNA sequence
>NC_021177, from 2111386 to 2111409 (24 bp); Streptomyces fulvissimus DSM 40593 CGGCGACGCCGACGGCCATGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2111055-2111849	Sequence	SFUL_1877 - Membrane protein (Protein is coded in complementary strand; from 2111849 to 2111055)