Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 2009017
End position: 2009040
Length: 24

DNA sequence
>NC_021177, from 2009017 to 2009040 (24 bp); Streptomyces fulvissimus DSM 40593 GTCGGAGTCGAAGTCGGCGTCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2008478-2010661	Sequence	SFUL_1789 - putative ATPase (Protein is coded in complementary strand; from 2010661 to 2008478)