Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1989645
End position: 1989668
Length: 24

DNA sequence
>NC_021177, from 1989645 to 1989668 (24 bp); Streptomyces fulvissimus DSM 40593 GGTGGGGGCGGGGGTGGCGGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1989202-1989699	Sequence	SFUL_1771 - Alkylhydroperoxidase like protein, AhpD family (Protein is coded in complementary strand; from 1989699 to 1989202)