Sequence retrieval

Genome: Streptomyces fulvissimus DSM 40593
Start position: 1978983
End position: 1979036
Length: 54

DNA sequence
>NC_021177, from 1978983 to 1979036 (54 bp); Streptomyces fulvissimus DSM 40593 GCCCGGCCAGGTGTATCCGTACGGCCAGGTGTATCCGTACGGCCGGGTGTATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1977783-1979660	Sequence	SFUL_1758 - Putative regulator (Protein is coded in complementary strand; from 1979660 to 1977783)